• Creator: tquinlan
• Population: 0
• Generation: 6
• Total Fitness: 6
• No. Votes: 1
• Avg. Fitness 6
• Created: 05/19/2019
• Genome: TCTAAGTATACAAGCGCAAATTGAGAGGCT
• Function:

  gradient[2](cos(numbers("yyy"))) if numbers("yyy") if numbers("yxx") > cos(numbers("yyy")) else gradient[2](cos(numbers("yyy"))) > cos(numbers("yyy")) else invert(cos(numbers("yyy")) if numbers("yxx") > numbers("yyy") else gradient[2](cos(numbers("yyy"))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.