• Creator: tquinlan
• Population: 0
• Generation: 6
• Total Fitness: 6
• No. Votes: 1
• Avg. Fitness 6
• Created: 05/19/2019
• Genome: TCTAAGTATACAAGCGCAAATTGAGAGGCT
• Function:

  cos(numbers("yyy")) if numbers("yxx") if cos(numbers("yyy")) > gradient[2](cos(numbers("yyy"))) else numbers("yyy") > invert(numbers("yyy") if gradient[2](cos(numbers("yyy"))) > cos(numbers("yyy")) else numbers("yxx")) else gradient[2](cos(numbers("yyy")))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.