• Creator: guest3961
• Population: 0
• Generation: 3
• Total Fitness: 1
• No. Votes: 1
• Avg. Fitness 1
• Created: 04/10/2021
• Genome: TAGCGGCGCATAAGTTTGAATCCGCGCGAG
• Function:

  logn(gradient[1](numbers('epe'))) if round(logn(gradient[1](numbers('epe'))), gradient[1](numbers('epe'))) > gradient[1](numbers('epe')) else exp(round(logn(gradient[1](numbers('epe'))), gradient[1](numbers('epe'))), logn(gradient[1](numbers('epe'))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.