header

genetic-algorithms.com

 

Inspect guest128_0_0_15

Parents

guest128_0_0_15 has no parents. It was generated at random.

guest128_0_0_15

Image 01

  • Creator: guest128
  • Population: 0
  • Generation: 0
  • Total Fitness: 8
  • No. Votes: 1
  • Avg. Fitness 8
  • Created: 05/19/2019
  • Genome: GGTTGATCATGGCTTATCGCAGGGCATGAC
  • Function:

    round(numbers('rep'), numbers("yyy")) if numbers('yxr') if numbers('rep') > numbers("yyy") else round(numbers('rep'), numbers("yyy")) > numbers('rep') else numbers("yyy") if round(numbers('rep'), numbers("yyy")) > round(numbers('rep'), numbers("yyy")) if numbers('rep') if round(numbers('rep'), numbers("yyy")) > numbers("yyy") else numbers('yxr') > round(numbers('rep'), numbers("yyy")) if numbers('yxr') if round(numbers('rep'), numbers("yyy")) > numbers('rep') else numbers("yyy") > numbers('rep') else numbers("yyy") else numbers('rep') else numbers('yxr') if numbers("yyy") > round(numbers('rep'), numbers("yyy")) else numbers('rep')

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

guest128_0_0_15 has no children. Either it's in the last generation of its population or it was unsuccessful in the ruthless process of natural selection!