• Creator: robertjamesd220
• Population: 0
• Generation: 1
• Total Fitness: 4
• No. Votes: 1
• Avg. Fitness 4
• Created: 05/18/2021
• Genome: CAGTAATGAAGAAAGACGTTGTCGCCTTAACAA
• Function:

  minus(sin(invert(100 *(numbers('epe')))) if 100 *(numbers('epe')) > invert(100 *(numbers('epe'))) else 100 *(numbers('epe')) if sin(invert(100 *(numbers('epe')))) > invert(100 *(numbers('epe'))) else numbers('epe'), invert(100 *(numbers('epe'))) if numbers('epe') > 100 *(numbers('epe')) else sin(invert(100 *(numbers('epe')))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.