• Creator: robertjamesd220
• Population: 0
• Generation: 1
• Total Fitness: 5
• No. Votes: 1
• Avg. Fitness 5
• Created: 05/18/2021
• Genome: ATGTAATGAAGAAAGACGTTGTCGGCCGATTAA
• Function:

  sqrt(100 *(numbers('epe')) if invert(100 *(numbers('epe'))) > sin(invert(100 *(numbers('epe')))) else numbers('epe') if invert(100 *(numbers('epe'))) > sin(invert(100 *(numbers('epe')))) else 100 *(numbers('epe')))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.