• Creator: robertjamesd220
• Population: 0
• Generation: 1
• Total Fitness: 1
• No. Votes: 1
• Avg. Fitness 1
• Created: 05/18/2021
• Genome: CGAAAGCGTATAATGTTTGAATCTCAACGT
• Function:

  mod(invert(log(logn(sqrt(numbers('rrr'))), sqrt(numbers('rrr')))), log(logn(sqrt(numbers('rrr'))), sqrt(numbers('rrr'))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.