• Creator: robertjamesd220
• Population: 0
• Generation: 3
• Total Fitness: 9
• No. Votes: 1
• Avg. Fitness 9
• Created: 05/18/2021
• Genome: TGGTGGGTACACACTTTGTCGCGTATCAGG
• Function:

  sum(2 *(numbers('epe')), numbers('epe')) if numbers('yxy') if sum(2 *(numbers('epe')), numbers('epe')) > numbers('epe') else 2 *(numbers('epe')) > 2 *(numbers('epe')) else numbers('epe') if sum(2 *(numbers('epe')), numbers('epe')) > 2 *(numbers('epe')) if sum(2 *(numbers('epe')), numbers('epe')) > numbers('yxy') else numbers('epe') else 2 *(numbers('epe'))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.