• Creator: robertjamesd220
• Population: 0
• Generation: 5
• Total Fitness: 3
• No. Votes: 1
• Avg. Fitness 3
• Created: 05/18/2021
• Genome: AGGTGGTGGGTACACACTACTTTGTAGCTCAGT
• Function:

  tan(2 *(numbers('xyy')) if 2 *(numbers('xyy')) if sum(2 *(numbers('xyy')), numbers('xyy')) > numbers('xyy') else 2 *(numbers('xyy')) if sum(2 *(numbers('xyy')), numbers('xyy')) > numbers('epe') else numbers('xyy') > sum(2 *(numbers('xyy')), numbers('xyy')) else numbers('epe') if numbers('xyy') > sum(2 *(numbers('xyy')), numbers('xyy')) else 2 *(numbers('xyy')))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.