• Creator: robertjamesd220
• Population: 0
• Generation: 7
• Total Fitness: 8
• No. Votes: 1
• Avg. Fitness 8
• Created: 05/18/2021
• Genome: TGAGAGTCAACCCTTACGGATGAAATTTCTCGC
• Function:

  round(100 *(numbers("yxx")), numbers("yxx")) if round(100 *(numbers("yxx")), numbers("yxx")) if round(100 *(numbers("yxx")), numbers("yxx")) if 10 *(round(100 *(numbers("yxx")), numbers("yxx"))) > 100 *(numbers("yxx")) else numbers("yxx") > 100 *(numbers("yxx")) else 10 *(round(100 *(numbers("yxx")), numbers("yxx"))) > 10 *(round(100 *(numbers("yxx")), numbers("yxx"))) else round(100 *(numbers("yxx")), numbers("yxx")) if 10 *(round(100 *(numbers("yxx")), numbers("yxx"))) > numbers("yxx") else 100 *(numbers("yxx"))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.