• Creator: robertjamesd220
• Population: 0
• Generation: 7
• Total Fitness: 3
• No. Votes: 1
• Avg. Fitness 3
• Created: 05/18/2021
• Genome: TTGTAGGCGACGCGGGATGAACAGATCAGT
• Function:

  numbers("yxx") if 100 *(exp(numbers("yxx"), numbers("xxx"))) > exp(numbers("yxx"), numbers("xxx")) else numbers("yxx") if exp(numbers("yxx"), numbers("xxx")) > numbers("xxx") else 100 *(exp(numbers("yxx"), numbers("xxx"))) if exp(numbers("yxx"), numbers("xxx")) > 100 *(exp(numbers("yxx"), numbers("xxx"))) if numbers("xxx") > numbers("yxx") else exp(numbers("yxx"), numbers("xxx")) else 100 *(exp(numbers("yxx"), numbers("xxx")))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.