• Creator: robertjamesd220
• Population: 0
• Generation: 8
• Total Fitness: 6
• No. Votes: 1
• Avg. Fitness 6
• Created: 05/18/2021
• Genome: CACGAGTCAACCCTAACCTAGTGCATCTCTGGC
• Function:

  sum(10 *(max(10 *(numbers("xyx")), numbers("xyx"))) if max(10 *(numbers("xyx")), numbers("xyx")) if 10 *(numbers("xyx")) > 10 *(max(10 *(numbers("xyx")), numbers("xyx"))) else numbers("xyx") > max(10 *(numbers("xyx")), numbers("xyx")) else 10 *(numbers("xyx")), max(10 *(numbers("xyx")), numbers("xyx")) if numbers("xyx") > 10 *(numbers("xyx")) else 10 *(max(10 *(numbers("xyx")), numbers("xyx"))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.