• Creator: robertjamesd220
• Population: 1
• Generation: 0
• Total Fitness: 3
• No. Votes: 1
• Avg. Fitness 3
• Created: 05/18/2021
• Genome: ACCCACGAAACCCTGCACATTTAGTATCCA
• Function:

  10 *(sum(numbers("xxy") if 10 *(mean(numbers("xxy"), numbers('rrr'))) > mean(numbers("xxy"), numbers('rrr')) else numbers('rrr'), 10 *(mean(numbers("xxy"), numbers('rrr')))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.