• Creator: robertjamesd220
• Population: 2
• Generation: 2
• Total Fitness: 1
• No. Votes: 1
• Avg. Fitness 1
• Created: 05/18/2021
• Genome: AGCAAACTGGCCACGATGAACAAAATGTGACCATAA
• Function:

  cos(abs(mean(100 *(sqrt(numbers("xxy"))) if sqrt(numbers("xxy")) > numbers("xxx") else numbers("xxy"), 100 *(sqrt(numbers("xxy"))))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.