header

genetic-algorithms.com

 

Inspect robertjamesd220_2_3_28

Parents

robertjamesd220_2_3_28 has no parents. It was generated at random.

robertjamesd220_2_3_28

Image 01

  • Creator: robertjamesd220
  • Population: 2
  • Generation: 3
  • Total Fitness: 1
  • No. Votes: 1
  • Avg. Fitness 1
  • Created: 05/18/2021
  • Genome: GGGAACGTGAGGTCGATCGTGCGGCTGCTT
  • Function:

    tan(numbers('yxr') if numbers('rep') > numbers('epe') else numbers('epe')) if numbers('rep') > numbers('epe') else numbers('yxr') if numbers('epe') > numbers('epe') else numbers('rep') if numbers('epe') if numbers('yxr') > numbers('epe') else numbers('rep') > square(tan(numbers('epe') if numbers('rep') > numbers('epe') else numbers('yxr')) if numbers('rep') > numbers('yxr') if numbers('epe') > numbers('epe') else numbers('rep') else numbers('epe')) else tan(numbers('yxr') if numbers('rep') > numbers('epe') else numbers('epe'))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

robertjamesd220_2_3_28 has no children. Either it's in the last generation of its population or it was unsuccessful in the ruthless process of natural selection!