• Creator: robertjamesd220
• Population: 2
• Generation: 4
• Total Fitness: 2
• No. Votes: 1
• Avg. Fitness 2
• Created: 05/18/2021
• Genome: ACCGTCATTCGCAAAACCCTGAACATCTCCCACTGA
• Function:

  10 *(10 *(numbers('epe')) if round(abs(10 *(numbers('epe'))), 10 *(numbers('epe'))) > abs(10 *(numbers('epe'))) else gradient[0](round(abs(10 *(numbers('epe'))), 10 *(numbers('epe')))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.