• Creator: robertjamesd220
• Population: 2
• Generation: 5
• Total Fitness: 3
• No. Votes: 1
• Avg. Fitness 3
• Created: 05/18/2021
• Genome: CTAAGCCATCATCGCACAGTGTATGGCATTGCCTAA
• Function:

  max(cos(minus(minus(round(gradient[2](numbers('epe')), numbers('epe')), gradient[2](numbers('epe'))), round(gradient[2](numbers('epe')), numbers('epe')))), minus(minus(round(gradient[2](numbers('epe')), numbers('epe')), gradient[2](numbers('epe'))), round(gradient[2](numbers('epe')), numbers('epe'))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.