• Creator: robertjamesd220
• Population: 2
• Generation: 5
• Total Fitness: 10
• No. Votes: 1
• Avg. Fitness 10
• Created: 05/18/2021
• Genome: AGTACCCTTCGCACTCATTATGGCTACCCCAAC
• Function:

  gradient[1](10 *(round(round(2 *(minus(numbers("yxx"), numbers('xry'))), minus(numbers("yxx"), numbers('xry'))), 2 *(minus(numbers("yxx"), numbers('xry'))))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.