• Creator: robertjamesd220
• Population: 2
• Generation: 5
• Total Fitness: 7
• No. Votes: 1
• Avg. Fitness 7
• Created: 05/18/2021
• Genome: TCGAGCGGGCGTCGCACTGAGTATGGCCCTGCCTTT
• Function:

  log(round(2 *(numbers("xyx")), numbers("xyx")), 2 *(numbers("xyx"))) if round(2 *(numbers("xyx")), numbers("xyx")) > round(2 *(numbers("xyx")), numbers("xyx")) if log(round(2 *(numbers("xyx")), numbers("xyx")), 2 *(numbers("xyx"))) > numbers("xyx") else 2 *(numbers("xyx")) else cos(2 *(numbers("xyx")) if round(2 *(numbers("xyx")), numbers("xyx")) > numbers("xyx") else log(round(2 *(numbers("xyx")), numbers("xyx")), 2 *(numbers("xyx"))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.