• Creator: robertjamesd220
• Population: 3
• Generation: 0
• Total Fitness: 5
• No. Votes: 1
• Avg. Fitness 5
• Created: 05/19/2021
• Genome: AAGTTGGTGAGGACACTGAACCATTCGACC
• Function:

  invert(numbers("xxy") if tan(gradient[2](numbers('epe'))) > gradient[2](numbers('epe')) else numbers('epe') if gradient[2](numbers('epe')) > numbers('epe') else tan(gradient[2](numbers('epe'))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.