header

genetic-algorithms.com

 

Inspect robertjamesd220_3_2_16

Parents

Mother

Image 01

robertjamesd220_3_1_27

Genome: TCTCCTTACCGACAGGCCGCTATGAGGTGC

Father

Image 01

robertjamesd220_3_1_19

Genome: GGGTACACAACTAGAAAGCTATGGAGCTGG

robertjamesd220_3_2_16

Image 01

  • Creator: robertjamesd220
  • Population: 3
  • Generation: 2
  • Total Fitness: 2
  • No. Votes: 1
  • Avg. Fitness 2
  • Created: 05/19/2021
  • Genome: CACTCGGACCCAACTAGAAAGCTATGTAGGTGC
  • Function:

    sum(sin(numbers("xyx")) if product(2 *(sin(numbers("xyx"))), sin(numbers("xyx"))) > sin(numbers("xyx")) if product(2 *(sin(numbers("xyx"))), sin(numbers("xyx"))) > 2 *(sin(numbers("xyx"))) else numbers("xyx") else 2 *(sin(numbers("xyx"))), numbers("xyx") if 2 *(sin(numbers("xyx"))) > product(2 *(sin(numbers("xyx"))), sin(numbers("xyx"))) else sin(numbers("xyx")))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

robertjamesd220_3_2_16 has no children. Either it's in the last generation of its population or it was unsuccessful in the ruthless process of natural selection!