• Creator: guest133
• Population: 0
• Generation: 1
• Total Fitness: 4
• No. Votes: 1
• Avg. Fitness 4
• Created: 05/19/2019
• Genome: ATCTGCCCTAGTAAACATCCATACTACGCT
• Function:

  band pass(abs(numbers("yxx")) if divide(gradient[1](abs(numbers("yxx"))), abs(numbers("yxx"))) > numbers("yxx") else gradient[1](abs(numbers("yxx"))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.