• Creator: robertjamesd220
• Population: 3
• Generation: 3
• Total Fitness: 3
• No. Votes: 1
• Avg. Fitness 3
• Created: 05/19/2021
• Genome: GTGACTAGGCACCTTGAGGTGGTTTGGGGG
• Function:

  round(numbers("xyx"), numbers('epe')) if sum(round(numbers("xyx"), numbers('epe')), numbers("xyx")) > tan(sum(round(numbers("xyx"), numbers('epe')), numbers("xyx"))) else 2 *(tan(sum(round(numbers("xyx"), numbers('epe')), numbers("xyx"))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.