• Creator: robertjamesd220
• Population: 3
• Generation: 3
• Total Fitness: 6
• No. Votes: 1
• Avg. Fitness 6
• Created: 05/19/2021
• Genome: ACAATTCTAAGACAACTTGCCATGAATATCTGT
• Function:

  gradient[2](gradient[0](max(sin(sum(round(numbers('yyx'), numbers('epe')), numbers('yyx'))), sum(round(numbers('yyx'), numbers('epe')), numbers('yyx')))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.