• Creator: robertjamesd220
• Population: 3
• Generation: 4
• Total Fitness: 2
• No. Votes: 1
• Avg. Fitness 2
• Created: 05/19/2021
• Genome: GTGACTAGGCACAAGCGCGGCTTGCCTAGA
• Function:

  sum(invert(numbers('xry')), numbers('xry')) if invert(numbers('xry')) > tan(sum(invert(numbers('xry')), numbers('xry'))) else 2 *(tan(sum(invert(numbers('xry')), numbers('xry'))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.