• Creator: robertjamesd220
• Population: 3
• Generation: 4
• Total Fitness: 3
• No. Votes: 1
• Avg. Fitness 3
• Created: 05/19/2021
• Genome: CACAAAGACAGTCGGCAGCCGACCGAAGGT
• Function:

  sum(abs(numbers("xyx") if numbers('yxy') > gradient[1](exp(numbers("xyx"), numbers('yxy'))) else exp(numbers("xyx"), numbers('yxy'))), numbers('yxy') if exp(numbers("xyx"), numbers('yxy')) > numbers("xyx") else gradient[1](exp(numbers("xyx"), numbers('yxy'))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.