• Creator: robertjamesd220
• Population: 3
• Generation: 5
• Total Fitness: 5
• No. Votes: 1
• Avg. Fitness 5
• Created: 05/19/2021
• Genome: CAGAAGATACTGCGCGAGCGGGTTACCATG
• Function:

  minus(invert(logn(mean(round(numbers("xyx"), numbers('yxr')), numbers("xyx")))), logn(mean(round(numbers("xyx"), numbers('yxr')), numbers("xyx"))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.