• Creator: robertjamesd220
• Population: 3
• Generation: 8
• Total Fitness: 7
• No. Votes: 1
• Avg. Fitness 7
• Created: 05/19/2021
• Genome: AGTACGCAGATTCACCTCTCCAGCTTTGCG
• Function:

  gradient[1](100 *(minus(gradient[0](sum(numbers('rep'), numbers('yyx'))), sum(numbers('rep'), numbers('yyx')))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.