• Creator: robertjamesd220
• Population: 3
• Generation: 9
• Total Fitness: 5
• No. Votes: 1
• Avg. Fitness 5
• Created: 05/19/2021
• Genome: TTTTTATATACGCAGACCCAGATCACGCTGAAG
• Function:

  100 *(minus(10 *(numbers("xyx")), numbers("xyx"))) if minus(10 *(numbers("xyx")), numbers("xyx")) > numbers("xyx") if minus(10 *(numbers("xyx")), numbers("xyx")) > 100 *(minus(10 *(numbers("xyx")), numbers("xyx"))) else 10 *(numbers("xyx")) else 100 *(minus(10 *(numbers("xyx")), numbers("xyx"))) if minus(10 *(numbers("xyx")), numbers("xyx")) > numbers("xyx") else 10 *(numbers("xyx")) if 100 *(minus(10 *(numbers("xyx")), numbers("xyx"))) > minus(10 *(numbers("xyx")), numbers("xyx")) else 10 *(numbers("xyx"))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.