• Creator: guest133
• Population: 0
• Generation: 2
• Total Fitness: 4
• No. Votes: 1
• Avg. Fitness 4
• Created: 05/19/2019
• Genome: CACCTCCCATAGACCAGGTTGAGACTCTAAAGA
• Function:

  sum(min(product(10 *(tan(numbers('epe'))) if numbers('epe') > numbers("xxr") else tan(numbers('epe')), 10 *(tan(numbers('epe')))), 10 *(tan(numbers('epe'))) if numbers('epe') > tan(numbers('epe')) else numbers("xxr")), product(10 *(tan(numbers('epe'))) if tan(numbers('epe')) > numbers('epe') else numbers("xxr"), 10 *(tan(numbers('epe')))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.