• Creator: robertjamesd220
• Population: 3
• Generation: 16
• Total Fitness: 4
• No. Votes: 1
• Avg. Fitness 4
• Created: 05/19/2021
• Genome: AGCCTCACACGGAGGAAACCACACGGGCGAGTT
• Function:

  cos(min(gradient[2](exp(tan(abs(numbers("yyy"))), abs(numbers("yyy")))), exp(tan(abs(numbers("yyy"))), abs(numbers("yyy")))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.