• Creator: robertjamesd220
• Population: 3
• Generation: 21
• Total Fitness: 2
• No. Votes: 1
• Avg. Fitness 2
• Created: 05/19/2021
• Genome: GCTAAATCATCACTTACTTTCTCCTCCCACAGG
• Function:

  numbers('rep') if 2 *(numbers('rep')) > round(2 *(numbers('rep')), numbers('rep')) else numbers('yyx') if round(2 *(numbers('rep')), numbers('rep')) if numbers('rep') > numbers('rep') if numbers('yyx') > round(2 *(numbers('rep')), numbers('rep')) else 2 *(numbers('rep')) else 2 *(numbers('rep')) > round(2 *(numbers('rep')), numbers('rep')) else abs(numbers('rep') if round(2 *(numbers('rep')), numbers('rep')) if numbers('rep') > 2 *(numbers('rep')) else numbers('yyx') > round(2 *(numbers('rep')), numbers('rep')) else 2 *(numbers('rep')))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.