• Creator: robertjamesd220
• Population: 3
• Generation: 22
• Total Fitness: 2
• No. Votes: 1
• Avg. Fitness 2
• Created: 05/19/2021
• Genome: ATCACTAATCACGACACACGATTCCGTGTCCGCCTTAGA
• Function:

  band pass(2 *(noise(sum(numbers('ryy') if numbers('rep') > mod(numbers('rep'), numbers('ryy')) else gradient[2](mod(numbers('rep'), numbers('ryy'))), gradient[2](mod(numbers('rep'), numbers('ryy')))))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.