• Creator: robertjamesd220
• Population: 3
• Generation: 22
• Total Fitness: 2
• No. Votes: 1
• Avg. Fitness 2
• Created: 05/19/2021
• Genome: CTTCGGAAGAAGACATGATCCGGTCGTGAT
• Function:

  round(exp(invert(invert(gradient[2](numbers("xxr")))), invert(gradient[2](numbers("xxr")))), invert(invert(gradient[2](numbers("xxr")))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.