• Creator: robertjamesd220
• Population: 3
• Generation: 22
• Total Fitness: 3
• No. Votes: 1
• Avg. Fitness 3
• Created: 05/19/2021
• Genome: ATGCTTCCGAGCGAGACCCAGCGAACGCGCGCT
• Function:

  sqrt(round(divide(cos(10 *(numbers("xyx")) if numbers("xxr") > numbers('yxy') else numbers("xyx")), 10 *(numbers("xyx")) if numbers("xxr") > numbers("xyx") else numbers('yxy')), cos(numbers("xyx") if numbers('yxy') > numbers("xxr") else 10 *(numbers("xyx")))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.