• Creator: robertjamesd220
• Population: 3
• Generation: 26
• Total Fitness: 6
• No. Votes: 1
• Avg. Fitness 6
• Created: 05/19/2021
• Genome: TCGCTACGCAGGATCACCGCCAAAGAAGCTAGCAGC
• Function:

  round(tan(band pass(10 *(numbers('yyx')))), band pass(10 *(numbers('yyx')))) if tan(band pass(10 *(numbers('yyx')))) > band pass(10 *(numbers('yyx'))) else max(round(tan(band pass(10 *(numbers('yyx')))), band pass(10 *(numbers('yyx')))), tan(band pass(10 *(numbers('yyx')))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.