• Creator: robertjamesd220
• Population: 3
• Generation: 27
• Total Fitness: 6
• No. Votes: 1
• Avg. Fitness 6
• Created: 05/19/2021
• Genome: GTGCCCCACTAAATGACCGCGTCACCTTGTGCG
• Function:

  sqrt(10 *(numbers('yxy'))) if sum(10 *(numbers('yxy')) if sqrt(10 *(numbers('yxy'))) > numbers("yyy") else numbers('yxy'), sqrt(10 *(numbers('yxy')))) > product(sum(10 *(numbers('yxy')) if numbers("yyy") > numbers('yxy') else sqrt(10 *(numbers('yxy'))), sqrt(10 *(numbers('yxy')))), 10 *(numbers('yxy')) if sqrt(10 *(numbers('yxy'))) > numbers("yyy") else numbers('yxy')) else numbers("yyy") if sqrt(10 *(numbers('yxy'))) > numbers('yxy') else 10 *(numbers('yxy'))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.