• Creator: robertjamesd220
• Population: 3
• Generation: 28
• Total Fitness: 2
• No. Votes: 1
• Avg. Fitness 2
• Created: 05/19/2021
• Genome: ACCGGCTTTGAGTAAACGACCGCGCTGTCATGG
• Function:

  10 *(numbers('yyx') if 100 *(numbers('yyx')) > numbers('epe') else numbers('yxy') if 100 *(numbers('yyx')) > 100 *(numbers('yyx')) if numbers('yyx') > numbers('yxy') if numbers('yyx') > 100 *(numbers('yyx')) else numbers('epe') else numbers('yxy') if 100 *(numbers('yyx')) if numbers('epe') > numbers('yxy') else numbers('yyx') > numbers('yyx') else 100 *(numbers('yyx')) else numbers('yyx') if 100 *(numbers('yyx')) > numbers('yxy') else numbers('epe') if numbers('yxy') > numbers('yyx') else 100 *(numbers('yyx')))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.