• Creator: robertjamesd220
• Population: 3
• Generation: 28
• Total Fitness: 2
• No. Votes: 1
• Avg. Fitness 2
• Created: 05/19/2021
• Genome: AGGCACTAGACTAATAACGTCGGTATAGTG
• Function:

  tan(sum(2 *(noise(numbers("xxy"))) if noise(numbers("xxy")) > numbers('rep') else numbers("xxy"), 2 *(noise(numbers("xxy")))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.