header

genetic-algorithms.com

 

Inspect guest4384_0_0_3

Parents

guest4384_0_0_3 has no parents. It was generated at random.

guest4384_0_0_3

Image 01

  • Creator: guest4384
  • Population: 0
  • Generation: 0
  • Total Fitness: 2
  • No. Votes: 1
  • Avg. Fitness 2
  • Created: 07/03/2021
  • Genome: GAATATGCGGCACGGTTGCAGAATCCAAAA
  • Function:

    numbers("xyx") if exp(numbers('epe'), numbers("xyx")) > numbers("yxx") else numbers('epe') if exp(numbers('epe'), numbers("xyx")) > exp(numbers('epe'), numbers("xyx")) if numbers('epe') > numbers("yxx") if numbers("xyx") > numbers('epe') else exp(numbers('epe'), numbers("xyx")) else exp(numbers('epe'), numbers("xyx")) if numbers('epe') > numbers("xyx") if numbers("yxx") > numbers('epe') else exp(numbers('epe'), numbers("xyx")) else numbers("xyx") else exp(numbers('epe'), numbers("xyx")) if numbers('epe') > numbers('epe') if exp(numbers('epe'), numbers("xyx")) > numbers("xyx") else numbers("yxx") else numbers("xyx")

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

guest4384_0_0_3 has no children. Either it's in the last generation of its population or it was unsuccessful in the ruthless process of natural selection!