header

genetic-algorithms.com

 

Inspect guest4401_0_0_8

Parents

guest4401_0_0_8 has no parents. It was generated at random.

guest4401_0_0_8

Image 01

  • Creator: guest4401
  • Population: 0
  • Generation: 0
  • Total Fitness: 1
  • No. Votes: 1
  • Avg. Fitness 1
  • Created: 07/06/2021
  • Genome: GGATCTATTATCGAAGTAATGGAGCAGTAG
  • Function:

    numbers("per") if numbers('epe') > numbers("xyx") else numbers("xyx") if band pass(numbers("xyx") if numbers("per") > numbers('epe') else numbers("xyx")) > gradient[0](band pass(numbers('epe') if numbers("xyx") > numbers("xyx") else numbers("per"))) else gradient[0](band pass(numbers("xyx") if numbers("xyx") > numbers('epe') else numbers("per"))) if numbers("per") > band pass(numbers("xyx") if numbers("xyx") > numbers('epe') else numbers("per")) else numbers("xyx") if numbers("per") > numbers("xyx") else numbers('epe')

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

guest4401_0_0_8 has no children. Either it's in the last generation of its population or it was unsuccessful in the ruthless process of natural selection!