• Creator: guest4571
• Population: 0
• Generation: 0
• Total Fitness: 3
• No. Votes: 1
• Avg. Fitness 3
• Created: 09/12/2021
• Genome: CTTCCGCCTCTCAACACTAAGAATGTAAGC
• Function:

  round(divide(divide(min(square(numbers('xyy')), numbers('xyy')), square(numbers('xyy'))), min(square(numbers('xyy')), numbers('xyy'))), divide(min(square(numbers('xyy')), numbers('xyy')), square(numbers('xyy'))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.