• Creator: guest4571
• Population: 0
• Generation: 1
• Total Fitness: 1
• No. Votes: 1
• Avg. Fitness 1
• Created: 09/12/2021
• Genome: GCAACGATCAAAACGCAGCGCGTCTCATGC
• Function:

  100 *(numbers("xyx")) if band pass(abs(100 *(numbers("xyx")))) > 100 *(band pass(abs(100 *(numbers("xyx"))))) else abs(100 *(numbers("xyx")))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.