• Creator: guest79
• Population: 0
• Generation: 14
• Total Fitness: 3
• No. Votes: 1
• Avg. Fitness 3
• Created: 05/19/2019
• Genome: ATGGTATAGAATAGTCAAGCGACGCAACTT
• Function:

  sqrt(gradient[1](numbers("xxx")) if numbers("xxx") > noise(gradient[1](numbers("xxx"))) else numbers('yxy') if noise(gradient[1](numbers("xxx"))) > numbers("xxx") else gradient[1](numbers("xxx")))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.