• Creator: guest79
• Population: 0
• Generation: 15
• Total Fitness: 8
• No. Votes: 1
• Avg. Fitness 8
• Created: 05/19/2019
• Genome: AGCTCTAAAACTCTTCAAAGCGATCCTATCCAGTTA
• Function:

  cos(round(sum(numbers('xry'), numbers("yxx")), numbers('xry')) if sum(numbers('xry'), numbers("yxx")) > abs(2 *(round(sum(numbers('xry'), numbers("yxx")), numbers('xry')))) else 2 *(round(sum(numbers('xry'), numbers("yxx")), numbers('xry'))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.