• Creator: guest79
• Population: 0
• Generation: 15
• Total Fitness: 8
• No. Votes: 1
• Avg. Fitness 8
• Created: 05/19/2019
• Genome: AGAAAGGATAATACGCGGTGCAATTTCGGA
• Function:

  sin(invert(numbers('xry') if 100 *(numbers('yxr')) > numbers('yxr') else noise(100 *(numbers('yxr')))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.