header

genetic-algorithms.com

 

Inspect guest4730_0_0_13

Parents

guest4730_0_0_13 has no parents. It was generated at random.

guest4730_0_0_13

Image 01

  • Creator: guest4730
  • Population: 0
  • Generation: 0
  • Total Fitness: 5
  • No. Votes: 1
  • Avg. Fitness 5
  • Created: 10/11/2021
  • Genome: TGAATGTCCATCTTTTCACCTAGCGTTGTT
  • Function:

    band pass(numbers('xyy') if numbers("yyy") > numbers('rrr') else numbers('xry')) if sqrt(numbers('xry') if numbers('rrr') > numbers('xyy') else numbers("yyy") if numbers("yyy") > numbers('xyy') else band pass(numbers("yyy") if numbers('xyy') > numbers('rrr') else numbers('xry'))) > band pass(numbers("yyy") if numbers('xyy') > numbers('xry') else numbers('rrr')) if numbers("yyy") > numbers('xry') if numbers('xyy') > numbers('rrr') else numbers("yyy") else numbers('xyy') else numbers('xyy') if numbers("yyy") > numbers('rrr') else numbers('xry')

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

guest4730_0_0_13 has no children. Either it's in the last generation of its population or it was unsuccessful in the ruthless process of natural selection!