• Creator: guest79
• Population: 0
• Generation: 17
• Total Fitness: 10
• No. Votes: 1
• Avg. Fitness 10
• Created: 05/19/2019
• Genome: AAAGACAACATACTAACTCTTCAAACCGTTTTCCCT
• Function:

  abs(2 *(numbers('rrr')) if max(2 *(numbers('rrr')), numbers('rrr')) > logn(max(2 *(numbers('rrr')), numbers('rrr'))) else square(logn(max(2 *(numbers('rrr')), numbers('rrr')))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.