• Creator: aretelicy
• Population: 0
• Generation: 0
• Total Fitness: 3
• No. Votes: 1
• Avg. Fitness 3
• Created: 11/11/2021
• Genome: TGAATTACCCCGATGACCGTACGTAAGAAG
• Function:

  sqrt(numbers('yyx')) if divide(sqrt(numbers('yyx')), numbers('yyx')) > 10 *(divide(sqrt(numbers('yyx')), numbers('yyx'))) else gradient[0](10 *(divide(sqrt(numbers('yyx')), numbers('yyx'))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.