• Creator: aretelicy
• Population: 0
• Generation: 0
• Total Fitness: 9
• No. Votes: 1
• Avg. Fitness 9
• Created: 11/11/2021
• Genome: GCACGAGCGATTACGCGCTAGGGCCACGGC
• Function:

  100 *(numbers('xry')) if gradient[0](100 *(numbers('xry'))) > mod(gradient[0](100 *(numbers('xry'))) if 100 *(numbers('xry')) > numbers('xry') else numbers("xyx"), gradient[0](100 *(numbers('xry')))) else 100 *(numbers('xry')) if numbers('xry') > numbers("xyx") else gradient[0](100 *(numbers('xry')))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.