• Creator: aretelicy
• Population: 0
• Generation: 0
• Total Fitness: 3
• No. Votes: 1
• Avg. Fitness 3
• Created: 11/11/2021
• Genome: CTAACGCTACTAATTCCTCAACGGCTGGCA
• Function:

  max(100 *(max(max(gradient[0](numbers('xyy')), numbers('xyy')), gradient[0](numbers('xyy')))), max(max(gradient[0](numbers('xyy')), numbers('xyy')), gradient[0](numbers('xyy'))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.